Wizualizacja sekwencji nukleotydów, sekwencja DNA

Problemy nauk ścisłych - dyskusje, teorie, kontakty
Modern-Science
Posty: 7

Wizualizacja sekwencji nukleotydów, sekwencja DNA

Post#1 » 06 sie 2015, czw, 14:45

Obrazek

TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAG TTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGA TATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT

CCGGTATGAATTCTCCGCGCAATAAGCCATCTCCCTACCGCATTGCATCAAAGCATTTCACAGCAGTCCAGCCC CGAGGTTCAGGGTCTCGGAGCTTCTGTCGACAGTAACAACCGGGTCGTGCCCGCCATCAATCGGTATCTTAAAT AAATAGAAATCTTTAGAGGCCGGTGGTAATACAGTTAGATCGACATAGTAAATAGGCTCAGAACTA

CTACGTATAAGGCGCTCTGATTGACGAAATGAGAACTAGAGCAGTACCGGGGAGGTCTTGTTAACTACGTTATA GGGAGCGCCCCTGCATTAACCCCCCCTGCGAGCTGTCATAGAAGCCCAATACGTGGACGTACCAATGAAGAGTA ACGACTCTAGTAGCGTCATGTACCACATACCCGTACTCAGACACACACGGGTACGCGATTGAGCACG

opis koncepcji i aplikacja są dostępne na tej stronie:
http://studia.scienceontheweb.net/visualization.php

autor: Grzegorz Podgórniak (2015)

Wróć do „Nauki ścisłe”

Kto jest online

Użytkownicy przeglądający to forum: Obecnie na forum nie ma żadnego zarejestrowanego użytkownika i 1 gość

cron